Place a checkmark next to each cellular component necessary to build a plant cell: plasma membrane
cell wall
DNA
nucleus
mitochondria
chloroplast
Golgi apparatus
rough endoplasmic reticulum
smooth endplasmic reticulum
flagella

Explain why biological control methods are generally environmentally superior to chemical pest control methods.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Interactions between organisms and their environment impact the organism’s overall population. the jaguar panthera onca is the largest cat in north america. it is found in areas across the southwest, including arizona, new mexico, and texas. it is a carnivore that has powerful jaws and sharp teeth and preys on fish, turtles, tapirs, and many smaller mammals. which shows the relationship between the jaguar and turtles?