subject
Biology, 16.02.2021 18:20 kristadwsn

S. O.S HELP BRAINLIEST IF RIGHT Assignment: Galapagos Islands Changes Exploration

Sources Used – List the URL’s of the websites used below:

Galapagos Islands Background
Location

Description of the islands
(size, how they are formed, climates)

Species of the islands

History of species of the islands

Darwin’s Research
What did he study?

What did he observe?

What did he conclude?

What scientific breakthrough did his conclusions lead to?

The Grants’ Research
Animal studied

Brief goal of their studies

What did they observe?

What did they conclude?

Questions
1. What did Darwin’s research on the Galapagos Islands show?

2. What did the Grant’s research on the Galapagos Islands show?

3. Describe how species on the Galapagos Islands have changed over time.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 22:00
Dna is colied into chromosomes in a cell
Answers: 2
question
Biology, 22.06.2019 05:30
“in 1492 columbus sailed the ocean blue” is an example of: a)explicit memory b) procedural memory c) semantic memory d)episodic memory
Answers: 3
question
Biology, 22.06.2019 10:00
What are the proteins in connectivity tissues of your foot examples of?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
S. O.S HELP BRAINLIEST IF RIGHT Assignment: Galapagos Islands Changes Exploration

Sourc...
Questions
Questions on the website: 13722367