3.Haz un gráfico con los datos de la tabla adjunta. Empieza en el año 0 y termina en 2007. Responde: a. ¿A qué tipo de crecimiento corresponde, lineal o exponencial?

b. ¿Qué bucle de retroalimentación coincide con este crecimiento?

—Enumera algunos factores que hayan contribuido a este aumento progresivo de la población mundial.​

One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails. b. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. c. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails have other functions,because prokaryotes don't have nuclei.

Which of the following is the earliest era of earth's geologic time scale? cenozoic mesozoic precambrian paleozoic

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?