subject
Biology, 25.02.2021 22:30 julietmusyoki5

O que propõem o desenvolvimento sustentável? A)É impossível sustentar o desenvolvimento
B)Pode haver desenvolvimento em harmonia com o meio ambiente
C)Para sustentar a indústria é necessário o desenvolvimento em detrimento do meio ambiente​

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 05:30
Where can a dna be found in a prokaryotic cell
Answers: 1
question
Biology, 22.06.2019 07:00
Which is the graph of the piecewise function f(x)? f(x) = image for option 1 image for option 2 image for option 3 image for option 4
Answers: 3
question
Biology, 22.06.2019 10:00
In what part of the body does the most muscle activity happen?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
O que propõem o desenvolvimento sustentável? A)É impossível sustentar o desenvolvimento
B)Pode...
Questions
Questions on the website: 13722361