subject
Biology, 10.03.2021 20:10 edgartorres5123

What are examples of a Decomposer? Small fish, zooplankton, manatees
Seals, tuna, octopuses
O Fungi, some bacteria, some insects

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 13:00
Which of the following are energy solutions that release pollution into the air>
Answers: 1
question
Biology, 22.06.2019 00:30
Experiments in environmental toxicology can sometimes be manipulative experiments in which the researcher actively chooses and manipulates the independent variable. in hunt's study, for example, dosages of bpa were manipulated and the effects were measured. in manipulative studies, the researcher controls all the other variables in the experiment, so any health effects observed in the test subjects can be attributed to differences in the independent variable. in other cases, researchers use natural experiments in which the dependent variable (typically a measure of organism health) is measured under differing contexts that are not manipulated. say, for example, that an accidental chemical spill contaminates five ponds. to determine the possible effects of the toxic chemical on frogs, a researcher could compare the hatching rate of frog eggs laid in those five ponds to the hatching rate of eggs laid in five uncontaminated ponds nearby. this would be an example of a natural experiment because concentrations of the toxic chemical in the ponds were not controlled by the experimenter, but rather resulted from the chemical spill. drag type of experiment on the left to the example of experiment on the right. blood concentrations of bpa in college students are compared to their recent manipulative consumption of canned food items 2. the feeding behavior of fish in streams that receive acidic runoff from strip mines is compared to the feeding behavior of fish in unaffected streams. the deformity rate in baby birds from nests in pesticide-sprayed fields is compared to the deformity rate in birds from nests in unsprayed fields 4 tumor development is compared in mice exposed to five dosages of a known carcinogen in the laboratory foraging activity levels are compared in tadpoles exposed to four concentrations of toxic metals in the laboratory. growth of corn plants is compared in field plots sprayed with three different dosage: s of weed killer 7 bpa concentrations in the urine of people with diabetes are compared to bpa concentrations in the urine of people without diabetes - natural; manipulative
Answers: 1
question
Biology, 22.06.2019 09:00
Select all that apply genes are specific nucleotide sequences occur in numbers that are the same as the number of chromosomes are located in a specific place on a chromosome determine the traits of an organism are units of rna
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are examples of a Decomposer? Small fish, zooplankton, manatees
Seals, tuna, octopuses
Questions
question
Mathematics, 08.10.2019 11:30
question
Mathematics, 08.10.2019 11:30
Questions on the website: 13722359