Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 20 million years. examine the dna segments from two different species:

species a: gtacctaagttcaccgaatt
species b: gaacctaagggcaccgaact

using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.

equal distribution i think.

a fossil fuel is a fuel formed by natural processes, such as anaerobic decomposition of buried dead organisms, containing energy originating in ancient photosynthesis.[1] the age of the organisms and their resulting fossil fuels is typically millions of years, and sometimes exceeds 650 million years.[2] fossil fuels contain high percentages of carbon and include petroleum, coal, and natural gas.[3] other commonly used derivatives include kerosene and propane. fossil fuels range from volatile materials with low carbon to hydrogen ratios like methane, to liquids like petroleum, to nonvolatile materials composed of almost pure carbon, like anthracite coal. methane can be found in hydrocarbon fields either alone, associated with oil, or in the form of methane clathrates.

the theory that fossil fuels formed from the fossilized remains of dead plants by exposure to heat and pressure in the earth's crust over millions of years was first introduced by andreas libavius "in his 1597 alchemia [alchymia]" and later by mikhail lomonosov "as early as 1757 and certainly by 1763".[4] the first use of the term "fossil fuel" was by the german chemist caspar neumann, in english translation in 1759.[5]

in 2017 the world's primary energy sources consisted of petroleum (34%), coal (28%), natural gas (23%), amounting to an 85% share for fossil fuels in primary energy consumption in the world.[6] non-fossil sources in 2006 included nuclear (8.5%), hydroelectric (6.3%), and others (geothermal, solar, tidal, wind, wood, waste) amounting to 0.9%.[7] world energy consumption was growing at about 2.3% per year. in 2015 about 18% of worldwide consumption was from renewable sources.[8]