Ben is an entomologist studying ant behavior. he wants to know whether ants are pollinators for a specific plant. in which stage of the plant’s life cycle should he check whether a significant number of adult ants are acting as pollinators?

Recombinant dna (rdna) creates offspring which are genetically identical to the parent is the process of breeding only organisms with desirable traits involves the removal of the nucleus of a cell combines genes from organisms of different species in a lab

Ineed to get this test done which of the following statements is correct in hour our immune system responds to a potential pathogen? a.) the skin will be the first line of defense, and then the many phagocytes in the bloodstream will attempt to consume the possible pathogen. b.) b cells will start reading the antigen code immediately and call t cells to assist in destroying the pathogen. c.) the adapted immune system will call on the innate immune system to destroy the pathogen. d.) the t-cells in the adapted immune systems are the first to recognize the pathogen

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?