subject
Biology, 18.09.2019 06:30 ciaraberger

Illustrate a brief distinction between accidents and risky behaviours and give one relevant exemple for each.

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:00
Other than earth, is also known to have magnetic pole reversal? a: venus b: mars c: earths moon d: the sun
Answers: 1
question
Biology, 22.06.2019 06:30
To sciences do not agree on which type of grocery bag is better for the environment what is most likely to come out come out of the disagreement
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:00
What will happen if two of the base pairs of the stand of the dna are switched
Answers: 1
You know the right answer?
Illustrate a brief distinction between accidents and risky behaviours and give one relevant exemple...
Questions
question
Mathematics, 30.06.2021 20:20
question
Mathematics, 30.06.2021 20:30
question
Mathematics, 30.06.2021 20:30
question
Mathematics, 30.06.2021 20:30
Questions on the website: 13722367