Read the following passage from the Biology Department at University of California, Berkeley. Northern elephant seals have reduced genetic variation because hunting by humans reduced their population size to as few as 20 individuals at the end of the 19th century. Their population has since rebounded to over 30,000, but their genes still carry the marks of this near extinction: they have much less genetic variation than a population of southern elephant seals that was not hunted as intensely.

Which of the following best describes how the population has evolved?
The population has not evolved because there was no change in allele frequencies.
The population has not evolved because it has grown.
The population has evolved because it has grown.
The population has evolved because there was a change in allele frequencies.

The first signs of cellular differentiation occur in the blastocyst. why is cellular differentiation important for the development of a fully formed human infant?

What is used to keep track of the gamates and possible offsprings combination

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?