![subject](/tpl/images/cats/biologiya.png)
Biology, 27.07.2021 21:40 miranda105
Given the enormous heterogeneity of antigen receptors expressed on the populations of naive B and T lymphocytes, the adaptive immune response relies on a process whereby the rare lymphocyte that binds to the antigen is first induced to proliferate, before it can perform its effector function. For B cells, there is a clever mechanism that ensures that the specificity of the antibody secreted by the plasma cell will recognize the same pathogen that initially stimulated the B cell antigen receptor and induced B cell proliferation. This mechanism is:
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:10
What noticeable trend from this graph might be used to make a conclusion?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
Anormal strand of dna is shown below, followed by the same strand of dna after mutations have occurred.
Answers: 3
You know the right answer?
Given the enormous heterogeneity of antigen receptors expressed on the populations of naive B and T...
Questions
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/istoriya.png)
History, 08.07.2021 18:10
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.07.2021 18:10
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 08.07.2021 18:10
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.07.2021 18:10
![question](/tpl/images/cats/mat.png)
Mathematics, 08.07.2021 18:10
![question](/tpl/images/cats/mat.png)
Mathematics, 08.07.2021 18:10
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 08.07.2021 18:20