What would be the primary structure of this small protein made from the following DNA sequence?
TACTCTGATAATGCCGTCATT

i don't know. if i were you, i would search it up online : d

glacial erosion, the picking up and movement of earth beneath a glacier, is also referred to as plucking. erosion and transportation of individual pieces of bedrock, especially large "joint block occur as a result of this glacial erosion. plucking is type of erosion in which rocks become frozen into the bottom and sides of the glacier.as the glacier moves downhill it 'plucks' the rocks frozen into the glacier from the ground.

fossil's are like over rated rocks like low key not gonna lie i don't get why we can't just call them old rocks like for real i mean i call my grandpa and grandma that smh

i think the answer is c hope this