subject

Chemistry, 23.02.2021 21:00 nerual0503

Question 2 2 C2H215)
+
5 O2(g)
->
4 CO2(g)
+
2 H2O(g)
If you start with 4.46 moles of C2H2, how many grams of CO2 can you expect to make?
Your answer
O 19.74 grams
98.14 grams
0 392.57 grams
o 785.14 grams

ansver

Answers: 1

Show answers

Another question on Chemistry

question

Chemistry, 22.06.2019 01:00

Which of the following is always a reactant in a combustion reaction? oxygen nitrogen hydrogen carbon

Answers: 1

question

Chemistry, 22.06.2019 09:50

Achemist has dissolved a certain substance in water. the chemist knows that more of the substance could be dissolved into the water before it stops dissolving. therefore

Answers: 2

question

Chemistry, 23.06.2019 05:30

Based on the formulas, select the compounds below that are covalent: kbr sif4 al2o3 co2 naco3 s7o2 pcl3 fe3n2 h2o s2f10

Answers: 3

question

Chemistry, 23.06.2019 07:30

Assume that 13.5 g solid aluminum (al) react with hcl to produce solid aluminum chloride (alcl3) salt and gaseous hydrogen (h2) at standard temperature and pressure.

Answers: 1

You know the right answer?

Question 2 2 C2H215)
+
5 O2(g)
->
4 CO2(g)
+
2 H2O(g)
...

Questions

question

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

question

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

question

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

question

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

question

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

question

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

question

Mathematics, 04.04.2020 14:01

Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...

question

Business, 04.04.2020 14:01

A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...

question

Business, 04.04.2020 14:01

Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...

question

Mathematics, 04.04.2020 14:01

He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...

question

Mathematics, 04.04.2020 14:01

Ashley picked up 15 rocks. 3 igneous, 3 metamorphic, and 9 sedimentary. What is the ratio of sedimentary rocks to the total number of rocks?...

question

Mathematics, 04.04.2020 14:01

Consider quadrilateral BCEF inscribed in circle A. Diagonals EB and CF intersect at point D. Select all the statements that are true about the diagram...

question

Business, 04.04.2020 14:01

Bay City uses the purchases method to account for supplies. At the beginning of the year the city had no supplies on hand. During the year the city pu...

question

Computers and Technology, 04.04.2020 14:01

All but one of the following statements about stored procedures is true. Which one is false? a. They consist of one or more SQL statements. b. They ar...

question

Business, 04.04.2020 14:01

In 2009 the federal excise tax on cigarettes was raised. In response, the CDC noted that "... because low-income groups are more responsive to price i...

question

Physics, 04.04.2020 14:02

Determina la magnitud de la fuerza que se debe aplicar a un sillón cuya masa es de 40 kg para que adquiera una aceleración con magnitud de 3 m/s²...

question

Business, 04.04.2020 14:02

Which of the following statements is false? Marginal cost will equal average total cost when average total cost is at its lowest point. When marginal...

question

Mathematics, 04.04.2020 14:02

B. Interpret the Rsquared value. Does the multiple regression equation help us predict the total golf score much better than we could without knowing...

question

Business, 04.04.2020 14:02

Quality control is best defined as: a. ensuring that the project deliverables or end items would be acceptable to the customer b....

question

Business, 04.04.2020 14:02

Prock Petroleum's stock has a required return of 15%, and the stock sells for $60 per share. The firm just paid a dividend of $1.00, and the dividend...

More questions: Chemistry Another questions

Questions on the website: 13722363