subject
Chemistry, 02.06.2021 01:00 RNBWBlight2037

Percent Yield 2H2+O2 → 2H20
33 grams of hydrogen gas reacts with
301 grams of oxygen gas. What is the
percent yield if the experiment produces
251 grams of water?

ansver
Answers: 1
Show answers

Another question on Chemistry

question
Chemistry, 22.06.2019 12:00
Which of the following units is not an official si unit? mole liter kilogram ampere
Answers: 1
Answer
question
Chemistry, 22.06.2019 15:20
Element before carbon on the periodic table
Answers: 1
Answer
question
Chemistry, 22.06.2019 17:30
Which material burns faster? metal aluminum
Answers: 2
Answer
question
Chemistry, 22.06.2019 20:20
Which formula equation represents the burning of sulfur to produce sulfur dioxide? s(s) + o2(g) 4502(9) 2h2s(s) + 302(g) —> 2h20(0) + 2502(9) 4fes2+1102 —> 2fe2o3 + 8502 2802(g) + o2(9) v205 , 2503(9)
Answers: 1
Answer
You know the right answer?
Percent Yield 2H2+O2 → 2H20
33 grams of hydrogen gas reacts with
301 grams of oxygen ga...
Questions
question
History, 29.12.2021 04:10
In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of col...
question
English, 29.12.2021 04:10
I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook...
question
SAT, 29.12.2021 04:10
The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....
question
SAT, 29.12.2021 04:10
Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side...
question
SAT, 29.12.2021 04:10
Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted...
question
Biology, 29.12.2021 04:10
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...
question
SAT, 29.12.2021 04:10
A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In...
question
Mathematics, 29.12.2021 04:10
What is 18 1/5 -7 3/5 as a mixed number in simplest form...
question
SAT, 29.12.2021 04:10
What are the typical sources of data which is used for data analytics....
question
Chemistry, 29.12.2021 04:10
Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping...
question
SAT, 29.12.2021 04:10
Which general trends in atomic radius and electronegativity are observed....
question
Health, 29.12.2021 04:10
a couple undergoes a workup for infertility, which shows that the man has a low sperm count. the couple asks why this is a problem because it only tak...
question
SAT, 29.12.2021 04:10
Which of these factors would be considered when making a location decision at the region or community level?....
question
Mathematics, 29.12.2021 04:10
Find the domain of f(x). f(x) = √9x+36...
question
SAT, 29.12.2021 04:10
Consider this reaction: 2h+ + co32- → h2o + co2. Identify each of the following as a product, a reactant, or a coefficient. Co32-: h2o: co2: the 2 in...
question
Mathematics, 29.12.2021 04:10
What is the radius, in inches, of a right circular cylinder if the lateral surface area is 24\pi square inches and the volume is 24\pi cubic inches...
question
Business, 29.12.2021 04:10
Your variable annuity charges administrative fees at an annual rate of 0.175 percent of account value. Your average account value during the year is $...
question
SAT, 29.12.2021 04:10
Which of the following statements best represents the message of this quotation?....
question
SAT, 29.12.2021 04:10
In the middle of the page draw a small oval oriented vertically....
question
Biology, 29.12.2021 04:10
3. Hydrogen peroxide is used as an antiseptic to kill bacteria in cuts and abrasions. Many of these are catalase positive, yet they are still killed b...
More questions: Chemistry Another questions
Questions on the website: 13722359
See results (0)