subject

Mathematics, 05.05.2020 06:35 larissacrystalow8g2w

I need on dis plz because we’re in quarantine and I’m also dumb

I need on dis plz because we’re in quarantine and I’m also dumb

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 22.06.2019 00:00

Julia bought 7 hats a week later half of all her hats were destroyed in a fire. there are now only 12 hats left with how many did she start

Answers: 1

question

Mathematics, 22.06.2019 00:00

Which choice names the hypotenuse of triangle xyz? a. segment yx b. segment yz c. segment ab d. segment zx

Answers: 3

question

Mathematics, 22.06.2019 01:00

First work with stencil one. use a combination of reflections, rotations, and translations to see whether stencil one will overlap with the original pattern. list the sequence of rigid transformations you used in your attempt, noting the type of transformation, the direction, the coordinates, and the displacement in

Answers: 3

question

Mathematics, 22.06.2019 01:30

Simplify the expression below -3(10x+4y)+6(6x-2y)

Answers: 2

You know the right answer?

I need on dis plz because we’re in quarantine and I’m also dumb
...

Questions

question

Social Studies, 02.08.2019 17:00

What effect would a british blockade of the mississippi have on the us economy during the war of 1812...

question

Mathematics, 02.08.2019 17:00

Which expression is equivalent to this number? 28 19/100...

question

English, 02.08.2019 17:00

In act 1 , scene 2 of macbeth , what does macbeth do to macdonwald ?...

question

English, 02.08.2019 17:00

There are a few subordinating conjunctions that can also act as prepositions. which of the following can act as both? choose the most correct answer....

question

Mathematics, 02.08.2019 17:00

Answer will mark the total capacity of 6 pitchers and 12 glasses is 21 liters. the capacity of a pitcher is 5 times that of a glass. find the capacit...

question

Social Studies, 02.08.2019 17:00

What did alaska and hawaii have in common in the late 1800s? a) both areas are islands in the pacific ocean. b) both areas were far from most of the...

question

Mathematics, 02.08.2019 17:00

Ineed like now ! simplify the expression : 7y + 3x + 3 - 2y + 6 what is the coefficient of y? what is the constant?...

question

Biology, 02.08.2019 17:00

What are pelvic bones in snakes an example of...

question

Biology, 02.08.2019 17:00

To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctat...

question

English, 02.08.2019 17:00

What is professor moriarty’s relationship with holmes?...

question

Health, 02.08.2019 17:00

Aclient can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thighs b: turned i...

question

Mathematics, 02.08.2019 17:00

30 seconds slower than godfrey's time algebraic expression...

question

Mathematics, 02.08.2019 17:00

Explain how to solve the problem below. in your response, you must analyze the given information, discuss a strategy or plan to solve the problem, det...

question

Mathematics, 02.08.2019 17:00

What is 5 to the second power plus 2 the the fifth power plus 1...

question

Mathematics, 02.08.2019 17:00

What is the nature of the solution set to the following system of equations? 3x − 5y =negative -1 6x − 10y = negative-3 no solutions one solution...

question

Mathematics, 02.08.2019 17:00

In a sale, normal prices are reduced by 10%. natalie bought a pair of shoes for £54. what was the original price of the shoes?...

question

Health, 02.08.2019 17:00

Question 2: a client can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thigh...

question

English, 02.08.2019 17:00

This is a point of view where the author uses pronouns like he and she in telling a story....

question

Mathematics, 02.08.2019 17:00

Avirus is spreading exponentially. the initial amount of people infected is 40 and it is increasing at a rate of 5% per day. how many people will be i...

question

History, 02.08.2019 17:00

Why were many americans interested in remaining isolationist?...

More questions: Mathematics Another questions

Questions on the website: 13722360