Mathematics, 20.09.2020 20:01 TimothyYash6684

If line b is perpendicular to line a, and line c is perpendicular to line a, what is the slope of line c? mc =

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:20

Plot the points (0,6), (3,15.8), and (9.5,0) using the graphing tool, and find the function

Answers: 2

Answer

Mathematics, 21.06.2019 16:40

This question awards 100 ! i really don’t want to fail i will also mark you !

Answers: 2

Answer

Mathematics, 21.06.2019 18:40

That table shows measurements (in invhes$ from cubes with different side lengths. which pairs of variables have a linear relationship? check all that apply

Answers: 3

Answer

Mathematics, 21.06.2019 19:40

Which of the binomials below is a factor of this exression? 16x^2+40xy+25y^2 a.4x-5y b. 2x-5y c.4x+5y d.2x+5y

Answers: 2

Answer

You know the right answer?

If line b is perpendicular to line a, and line c is perpendicular to line a, what is the slope of li...

Questions

Mathematics, 16.04.2020 23:14

What is the area of the sector, in square units, determined by an arc with a measure 45° in a circle with radius 6? Round to the nearest tenth...

History, 16.04.2020 23:14

I WILL GIVE BRAINLIEST IF ANSWERED IN THE NEXT 10 MINUTES!!!Which of the following statements about the Civil War is FALSE?a.

Biology, 16.04.2020 23:14

If 10 percent of energy moves up to the next level of the ecosystem, what percentage of energy is lost as heat?...

Social Studies, 16.04.2020 23:14

At the conclusion of the Reconquista, there were no more Islamic states in A. Eastern Europe. B. Western Europe. C. East Asia. D. North Africa....

Mathematics, 16.04.2020 23:14

3) 4 friends equally share 13 of a pan of brownies. How much of the whole pan of brownies does each friend get?...

Mathematics, 16.04.2020 23:14

The angle of elevation of the top of a flagpole from a point on the ground 30 meters from the base of the flagpole is 18 degrees. What is the he...

English, 16.04.2020 23:14

What are examples of two species dividing up the parts of a habitat...

Business, 16.04.2020 23:14

Pasadena Candle Inc. projected sales of 800,000 candles for the year. The estimated January 1 inventory is 35,000 units, and the desired December 31 i...

Arts, 16.04.2020 23:14

Which of the following was popular compositional technique during the renaissance...

Biology, 16.04.2020 23:14

What is Nonconsciousness...

Mathematics, 16.04.2020 23:14

Which could be the length of KL?...

Biology, 16.04.2020 23:14

The Punnett square obtained by the dihybrid cross between two pea plants is shown in the table. Both plants have genotype RrYy. Based on the above dat...

English, 16.04.2020 23:14

Miss Meriwether of the missionary circle complains about her cooks and fieldhands what does that tell us about her...

Business, 16.04.2020 23:14

Eastern Corporation has $1,000 par value bonds with 4 years to maturity. The bonds pay an 8% coupon rate with semi-annual coupon interest payments. Th...

Mathematics, 16.04.2020 23:14

Gravel is being dumped from a conveyor belt at a rate of 20 cubic feet per minute. It forms a pile in the shape of a right circular cone whose base di...

Spanish, 16.04.2020 23:14

10 citas textuales donde puedan ubicar figuras heroicas...

Mathematics, 16.04.2020 23:14

F(x) = (x – 4)(x + 2)? which point is an x intercept of the quadratic function...

Mathematics, 16.04.2020 23:14

The measure of a central angle is 80 degrees. The length of the radius is 40 mm. Determine the arc length....

Biology, 16.04.2020 23:14

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Chemistry, 16.04.2020 23:14

Consider N O2 molecules in a container of volume V at a pressure of P=1 atm and a temperature of T=298K. a. Calculate the collision frequency Z1 of a...

More questions: Mathematics Another questions