Mathematics, 21.09.2020 23:01 giannav57

Please help! Brainliest to best answer!!

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 19:30

Are triangles the congruent? write the congruency statement.what is the congruency that proves they are congruent? what is the perimeter of ∆pqr?

Answers: 1

Answer

Mathematics, 22.06.2019 00:30

y=2x−1 5x−4y=1 is (1,1)(1,1) a solution of the system?

Answers: 1

Answer

Mathematics, 22.06.2019 03:30

What is the measure of angle a and angle c ?

Answers: 1

Answer

Mathematics, 22.06.2019 04:30

The width of a piece of rectangular land is 5m shorter rhan 1/3 of its length .find the width of the land if the length is 60m,150m.

Answers: 3

Answer

You know the right answer?

Please help! Brainliest to best answer!!
...

Questions

Biology, 24.06.2021 18:50

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGC...

Social Studies, 24.06.2021 18:50

Whats the song with gunna that be like"desingner head to toe sip to the head to flow"...

Chemistry, 24.06.2021 18:50

Observe the movement of the neon molecules in the chamber. Then, one at a time, select argon, oxygen, and water, and observe the movement of the atoms...

Business, 24.06.2021 18:50

Suppose that there is no third-party payer in the medical care market in Uganda in 1955. Suppose that in 1960, health insurance companies begin operat...

Mathematics, 24.06.2021 18:50

Consider the diagram. Parallel lines r and s are cut by transversal q. On line r where it intersects line q, 4 angles are created. Labeled clockwise,...

Chemistry, 24.06.2021 18:50

Chlorine has 17 total electrons with electron configuration 1s^2 2s^2 2p^6 3s^2 3p^5. What are the first three quantum numbers for the sic electrons i...

Social Studies, 24.06.2021 18:50

Please help..What makes a good essay? Describe the 3 parts (Introduction, Body, and Conclusion) and elements needed to have a well written essa...

Biology, 24.06.2021 18:50

I’m kinda stuck on this question ...

History, 24.06.2021 18:50

How is socialism different from capitalism? A. Socialist countries promote fascism, while capitalist countries promote totalitarianism. B...

Chemistry, 24.06.2021 18:50

Calculate RMM given Aluminium sulphate given RAM: A1-27; S-32; 0-16...

Business, 24.06.2021 18:50

A consumer has $180 in monthly income to spend on two goods, D and G, where D is on the y-axis. The price of good D, PD is $6, and the marginal rate o...

Business, 24.06.2021 18:50

At Cool Clothes Inc., there is a total focus on providing care and satisfaction to each customer. In the major clients division, each manager is assig...

Business, 24.06.2021 18:50

Rex and Kelsey are partners who share income in the ratio of 3:2. Their capital balances are $95,000 and $140,000, respectively. Income Summary has a...

Physics, 24.06.2021 18:50

A swimmer heading directly across a river that is 200 m wide reaches the opposite bank in 6 min 40 s. During this swim, she is swept downstream 480 m....

Business, 24.06.2021 18:50

Mason is the head of an automobile firm. The firm has two manufacturing units, one located in a city and the other located in a town. The manufacturin...

Social Studies, 24.06.2021 18:50

A business that wants to increase productivity for its main product heeus lu. A. create an advertising campaign to promote the product. B...

History, 24.06.2021 18:50

Someone who was given a land grant by Mexico to settle an area of Texas and was responsible for settlers on that land was called a(n) . a. baro...

History, 24.06.2021 18:50

The enlightment thinkers influence the creation of the declaration of independence because they proposed ideas about...

English, 24.06.2021 18:50

15. Tom Hanks is than me. A) more famous B) the most famous C) famouser D) the more famous 16. The station is as the bus stop. A) as nearer B) more...

Mathematics, 24.06.2021 18:50

The base of a power is......

More questions: Mathematics Another questions