subject

Mathematics, 07.12.2020 22:00 supermansabeast

Please help, 10 mins till its due Which of the following equations represent a proportional relationship? A. 2/3+a=b

B. m=1/5n

C. 2x=y+1

D. x=3y

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 18:30

Select the lengths in centimeters that would form a right triangle

Answers: 1

question

Mathematics, 21.06.2019 19:30

Acourt reporter is transcribing an accident report from germany. the report states that the driver was traveling 80 kilometers per hour. how many miles per hour was the driver traveling?

Answers: 2

question

Mathematics, 21.06.2019 19:30

Suppose i pick a jelly bean at random from a box containing one red and eleven blue ones. i record the color and put the jelly bean back in the box. if i do this three times, what is the probability of getting a blue jelly bean each time? (round your answer to three decimal places.)

Answers: 1

question

Mathematics, 21.06.2019 22:00

Prove sin2a + cos2a - 1 / sin2a + cos2a + 1 = 1 - tana / 1 + cota

Answers: 2

You know the right answer?

Please help, 10 mins till its due Which of the following equations represent a proportional relation...

Questions

question

Mathematics, 22.06.2020 11:57

you secure a mortgage to buy a house with a loan of $140,000 at 8.5% for 20 years. answer the following questions about that loan for the first two mo...

question

Social Studies, 22.06.2020 11:57

Concepto de territorio...

question

Mathematics, 22.06.2020 11:57

Sean wants to buy a personal insurance policy that will pay monthly benefits to his son after Sean dies. He pays $500 monthly over the next 10 years...

question

Mathematics, 22.06.2020 11:57

A marble dropped in still water will create circular ripples or waves. The radius of each circular wave will increase 4 centimeters per second. What...

question

Mathematics, 22.06.2020 11:57

Nstruction Active Proving That All Circles Are Similar Statements Reasons Given: Circle X with radius r and circle Y with rad...

question

Mathematics, 22.06.2020 11:57

NEED ANSWER NOWGraph a triangle (LMN) and reflect it over the line y=x to create triangle L’M’N Descirbe the transformation using words. Draw a line s...

question

Chemistry, 22.06.2020 11:57

Question * (4 Points) Solid E was iron(11) sulfate. Complete the expected observations. Solid E was added to distilled water in a test-tu...

question

Business, 22.06.2020 11:57

Melissa and Melinda, both calendar-year taxpayers, each own a 20% interest in Partnership tnt techron inc, whose fiscal years ends on June 30th 2019,...

question

English, 22.06.2020 11:57

Read the excerpt below and answer the question. As I said these things I got scared. It felt like worms and toads and slimy things crawling out of my...

question

Biology, 22.06.2020 11:57

1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'Given that the temperature required breaking, one bond in...

question

Mathematics, 22.06.2020 11:57

3 What is the y-coordinate of the point that divides the directed line segment from J to k into a ratio of 5:1? 2 1 AK (7,2

question

History, 22.06.2020 11:57

Which statement below most accurately describes the moral arguments for and against slavery in the 1800s? Supported of slavery insisted I...

question

Mathematics, 22.06.2020 12:57

A hotel with 95 room has 65 for doubles and 25 for singles. Singles can be booked in any room, but reservations for two or more people must be booked...

question

Mathematics, 22.06.2020 12:57

Cumulative Exam Active 21 30 TIME REMAINING 02:34:47 c A triangle on a coordinate plane is translated according t...

question

Mathematics, 22.06.2020 12:57

Tripp needs to travel a rectangular grid that is 10 blocks east and 4 blocks south (and he's only moving east and south). What is the probability Trip...

question

Spanish, 22.06.2020 12:57

Choose the answer that best relates to the class or field of study listed below. la programación a. las ciencias sociales c. la informática b. el arte...

question

History, 22.06.2020 12:57

Help Roosevelt's 'corollary' was adapted from the Monroe Doctrine to protect unstable Latin American nations from being controlled by the Europ...

question

Biology, 22.06.2020 12:57

Which sugar is present in the nucleic acid that is represented in the diagram? uracil thymine deoxyribose ribose...

question

Business, 22.06.2020 12:57

“Creditors do not actually have to worry about their dues in case the business fails.” In which form of business is this possible? Which special feat...

question

Social Studies, 22.06.2020 12:57

What is tradition? Write on your own ways....

More questions: Mathematics Another questions

Questions on the website: 13722362