Mathematics, 11.02.2021 02:10 Jerrygordon212

Find the real or imaginary solutions of the following equation by factoring.
x3 - 512=0

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 20.06.2019 18:04

When can u say there is no solution for a system of linear inequalities? explain your answer and show with a system and graph

Answers: 2

Answer

Mathematics, 22.06.2019 01:30

Classify the following number. −9.070707…

Answers: 1

Answer

Mathematics, 22.06.2019 01:40

Shape a is congruent to shape , as shown by a reflection across the y-axis and then a translation down units. shape b is congruent to shape , as shown by a reflection across the y-axis and then a translation down units.

Answers: 2

Answer

Mathematics, 22.06.2019 04:00

Simplify each expression for 18, 20, and 21

Answers: 1

Answer

You know the right answer?

Find the real or imaginary solutions of the following equation by factoring.
x3 - 512=0...

Questions

English, 06.12.2021 08:30

Identify and write the prepositional phrases in the following sentences. 1. Did your car stall on the viaduct? Mine did that once, when I was drivin...

Engineering, 06.12.2021 08:40

6.03 Discussion: Then & Now - Safety Discussion Topic I'm Done In this unit, you have learned about the evolution of the industry’s...

Biology, 06.12.2021 08:40

Which statement best describes adaptation: A. A lily suddenly mutates its tissues to store more water in a drought. B. Fish swim away from sudden sour...

English, 06.12.2021 08:40

What do these lines from stanza 5 reveal about the Pardoner? I stand up like a scholar in a pulpit, And when the ignorant people all do sit,

Mathematics, 06.12.2021 08:40

The amount of milk available per child in a day care center is given by the function Mlu)= where x is the number of children and is the quantity of...

Mathematics, 06.12.2021 08:40

Select of the equivalent representations of 1/10x10x10...

English, 06.12.2021 08:40

class 6to 11 students come here I will give you notes class is started come plz plz and it is free class no fee need fast come students plz plz plz pl...

Mathematics, 06.12.2021 08:40

A 4. An architect made a scale drawing on a grid of the front of an arch for a public park. Each box on the architect's grid measures 1...

Chemistry, 06.12.2021 08:40

Please help me with this I need this asap because submission of mine is 4:00 pm

Mathematics, 06.12.2021 08:40

Newton's Second Law of Motion states that the acceleration of an object is directly proportional to the force exerted on the object. If an object ac...

Mathematics, 06.12.2021 08:40

In general, the mechanical advantage of a simple machine is... A. please help quick the amount of force needed with the machine...

Mathematics, 06.12.2021 08:40

Pls help asap thx 1. Mr. Voeller and his band want to play at a venue in Oakland, but it is a gig that will last all night long. As a teacher...

History, 06.12.2021 08:40

From 1775-1825 what issue most divided the United States?...

History, 06.12.2021 08:40

Plz answer quick if u can i need it soon ...

Mathematics, 06.12.2021 08:40

What is solve 10<-2/3(9+12b)...

Mathematics, 06.12.2021 08:40

I need help what is the square root of 5*12/5...

Computers and Technology, 06.12.2021 08:40

Fill in the blacks 1-9 are my answer options for 10-12

Biology, 06.12.2021 08:40

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

Mathematics, 06.12.2021 08:40

I need help finals are crushing me pls help ...

Mathematics, 06.12.2021 08:40

V. Directions: Answer the following questions. Show your solution, 10. What is the smallest decimal number with two decimal places that becomes 0.5...

More questions: Mathematics Another questions

Find the real or imaginary solutions of the following equation by factoring. x3 - 512=0

Answers

Another question on Mathematics

Find the real or imaginary solutions of the following equation by factoring.
x3 - 512=0