Mathematics, 16.08.2021 16:20 princesstn28oqlfir

Para realizar a reforma de um estádio de futebol em 12 meses foram contratados 52 funcionários. quantas operários maís precisarão ser contratados para termina a obra em 8 meses

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:30

The sum of these consecutive integers is equal to 9 less than 4 times the least of the integer. find the three integers

Answers: 1

Answer

Mathematics, 21.06.2019 20:30

What’s -11-33k and factor each expression completely

Answers: 2

Answer

Mathematics, 21.06.2019 23:00

Which graph represents the linear function below? y-3=1/2(x+2)

Answers: 2

Answer

Mathematics, 21.06.2019 23:30

Which numbers have the same absolute value? choose all that apply. asap will mark at brainliest

Answers: 1

Answer

You know the right answer?

Para realizar a reforma de um estádio de futebol em 12 meses foram contratados 52 funcionários. quan...

Questions

Biology, 10.03.2020 08:08

The structure of the spinal cord can be described as (1) composed of thirty-one segments (2) having a cervical enlargement, lumbar enlargement, and tw...

Business, 10.03.2020 08:08

On September 1, Year 1, Orville Corporation has unrestricted Retained Earnings of $8,300,000, Appropriated Retained Earnings of $5,300,000, Cash of $9...

Mathematics, 10.03.2020 08:08

Men have head breadths that are normally distributed with a mean of 6.0 inches and a standard deviation of 1.0 inch. Engineers must consider the bread...

Mathematics, 10.03.2020 08:08

Consider a sample of rubber bands. Their weights are measured and found to have a variance of 2.57. Give a point estimate for the population variance...

Biology, 10.03.2020 08:08

are multiple arteries that fuse in order to serve a single capillary network. are multiple arteries that fuse in order to serve a single capillary ne...

Computers and Technology, 10.03.2020 08:08

Question 4. Use simulate_several_key_strikes 1000 times, each time simulating the monkey striking 11 keys. Compute the proportion of times the monkey...

Business, 10.03.2020 08:08

Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...

Business, 10.03.2020 08:08

The purpose of is to conceive, analyze, and creatively select channels of communication that will direct advertising messages to the right people in...

Physics, 10.03.2020 08:08

In terms of impulse and conservation of momentum, explain why a glass is much more likely to break if it falls onto a cement floor than if it falls on...

Business, 10.03.2020 08:08

Unlike manufacturers, buy products from other businesses but do not significantly alter the form of the products they buy before selling them....

More questions: Mathematics Another questions