subject

Mathematics, 25.07.2019 23:00 duauifja

The expression below represents the number of boxes of cookies sold by a girl scouts troop with 14 members at the school fair, where x is the number of days after the first day of the fair. 14(22x)+350 interpret the meaning of each term in the expression.

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 14:30

Find a number such that if you add 8 and divide the result by 4 you will get the same answer as if you subtracted 3 from the original number and divided by 2

Answers: 3

question

Mathematics, 21.06.2019 17:30

The graph below represents the number of dolphins in a dolphin sanctuary. select all the key features of this function.

Answers: 2

question

Mathematics, 21.06.2019 22:40

Which of the following circles have their centers on the x-axis? check all that apply.

Answers: 1

question

Mathematics, 21.06.2019 23:00

Delbert keeps track of total of the total number of points he earns on homework assignments, each of which is worth 60 points. at the end of the semester he has 810 points. write an equation for delbert’s average homework score a in terms of the number of assignments n.

Answers: 3

You know the right answer?

The expression below represents the number of boxes of cookies sold by a girl scouts troop with 14 m...

Questions

question

Biology, 24.06.2021 18:50

Witch characteristics do Jupiter and Saturn share...

question

Social Studies, 24.06.2021 18:50

The struggle for equal rights is still ongoing. Minorities face many struggles in acquiring social, political, and economic equality. While de jure di...

question

Biology, 24.06.2021 18:50

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGC...

question

Social Studies, 24.06.2021 18:50

Whats the song with gunna that be like"desingner head to toe sip to the head to flow"...

question

Chemistry, 24.06.2021 18:50

Observe the movement of the neon molecules in the chamber. Then, one at a time, select argon, oxygen, and water, and observe the movement of the atoms...

question

Business, 24.06.2021 18:50

Suppose that there is no third-party payer in the medical care market in Uganda in 1955. Suppose that in 1960, health insurance companies begin operat...

question

Mathematics, 24.06.2021 18:50

Consider the diagram. Parallel lines r and s are cut by transversal q. On line r where it intersects line q, 4 angles are created. Labeled clockwise,...

question

Chemistry, 24.06.2021 18:50

Chlorine has 17 total electrons with electron configuration 1s^2 2s^2 2p^6 3s^2 3p^5. What are the first three quantum numbers for the sic electrons i...

question

Social Studies, 24.06.2021 18:50

Please help..What makes a good essay? Describe the 3 parts (Introduction, Body, and Conclusion) and elements needed to have a well written essa...

question

Biology, 24.06.2021 18:50

I’m kinda stuck on this question ...

question

History, 24.06.2021 18:50

How is socialism different from capitalism? A. Socialist countries promote fascism, while capitalist countries promote totalitarianism. B...

question

Chemistry, 24.06.2021 18:50

Calculate RMM given Aluminium sulphate given RAM: A1-27; S-32; 0-16...

question

Business, 24.06.2021 18:50

A consumer has $180 in monthly income to spend on two goods, D and G, where D is on the y-axis. The price of good D, PD is $6, and the marginal rate o...

question

Business, 24.06.2021 18:50

At Cool Clothes Inc., there is a total focus on providing care and satisfaction to each customer. In the major clients division, each manager is assig...

question

Business, 24.06.2021 18:50

Rex and Kelsey are partners who share income in the ratio of 3:2. Their capital balances are $95,000 and $140,000, respectively. Income Summary has a...

question

Physics, 24.06.2021 18:50

A swimmer heading directly across a river that is 200 m wide reaches the opposite bank in 6 min 40 s. During this swim, she is swept downstream 480 m....

question

Business, 24.06.2021 18:50

Mason is the head of an automobile firm. The firm has two manufacturing units, one located in a city and the other located in a town. The manufacturin...

question

Social Studies, 24.06.2021 18:50

A business that wants to increase productivity for its main product heeus lu. A. create an advertising campaign to promote the product. B...

question

History, 24.06.2021 18:50

Someone who was given a land grant by Mexico to settle an area of Texas and was responsible for settlers on that land was called a(n) . a. baro...

question

History, 24.06.2021 18:50

The enlightment thinkers influence the creation of the declaration of independence because they proposed ideas about...

More questions: Mathematics Another questions

Questions on the website: 13722359