Physics, 24.11.2020 19:00 Bladen6579

A girl is riding her bike at a speed of 12 m/s. She weighs 55 kg and her bike weighs 22 kg. What is the KE of the girl and her bike?

Answers: 3

Show answers

Another question on Physics

Physics, 21.06.2019 22:30

Acricket ball of 70g moving with a velocity of 0.5 m/s is stopped by a player in 0.5s what is the force applied to stop the ball

Answers: 1

Answer

Physics, 21.06.2019 23:20

Which quantities are scalars? choose all that apply a.distance b.speed c. acceleration d.velocity

Answers: 2

Answer

Physics, 22.06.2019 04:30

In a voltaic cell, electrons flow from the (positive/negative) to the (positive/negative) terminal.

Answers: 1

Answer

Physics, 22.06.2019 05:30

Acombination reaction is when two or more combine to form one product. a decomposition reaction is when a substance breaks down into two or more simpler substances in a chemical reaction.

Answers: 1

Answer

You know the right answer?

A girl is riding her bike at a speed of 12 m/s. She weighs 55 kg and her bike weighs 22 kg. What is...

Questions

Mathematics, 22.01.2021 04:00

Sanjeep takes out a $250,000 mortgage. The yearly interest rate on the loan is 5% and the loan is for 25 years. Calculate the total amount of interest...

Mathematics, 22.01.2021 04:00

Which is the standard form of the equation of a parabola with a focus of (8,0) and directrix x = -8? y2 =-8 y2 = 8x y2 = 32x y = -3...

Biology, 22.01.2021 04:00

PLEASE HELP TIMED The host is calculating how many grams of limestone will be washed away by 30 kg of sulfur. He first converted kilograms to grams....

Mathematics, 22.01.2021 04:00

Select the correct answer from each drop-down menu. Joanne purchased a new computer for $1,700. She will need to pay $80 each month, Interest free, t...

Mathematics, 22.01.2021 04:00

Write an equation for a line perpendicular to y=-3x + 1 and passing through the point (6,-2)...

Mathematics, 22.01.2021 04:00

The missing exponent 1,728 =12 (?)...

Mathematics, 22.01.2021 04:00

What value of y would make {(-2, 18), (3, y), (6, 6), (-18, 2), (4, 9)} an inverse variation?...

Mathematics, 22.01.2021 04:00

Sin(x+22.5)=cos(x-16.5) what is the value of x?...

Mathematics, 22.01.2021 04:00

- Think Critically Oxygen-16 and oxygen- 17 are isotopes of oxygen. The numbers 16 and 17 represent their mass numbers, respectively. If...

Mathematics, 22.01.2021 04:00

Find the value of a. Hint: Draw in the altitude. Pls explain your answers. Thanks in Advance!

Mathematics, 22.01.2021 04:00

5 people went to the store. Each bought a candy bar for $1.50 and an orange for x dollars. When they were finished they spent $10.80...

Biology, 22.01.2021 04:00

2 DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:...

English, 22.01.2021 04:00

PLS HELP !! WORTH 67 POINTS AND I WILL MARK BRAINLIEST ! THIS IS DUE 11:59PM !! Directions: As you read "The Case Against High School Sports," identi...

Mathematics, 22.01.2021 04:00

7. What type of lines does the system y=3x+2 and 3x-y=-2 form?...

Mathematics, 22.01.2021 04:00

Work out the size of angle A. A 11 cm 9 cm 38° B С...

Mathematics, 22.01.2021 04:00

The hudson family is saving for a family vacation to Disney World. They determine that the trip will cost $3,200. Mr and Mrs. Hudson have already set...

Mathematics, 22.01.2021 04:00

Juan has a summer job delivering newspapers. He is paid $15 per hour and a $10 bonus when he completes his daily route ifh represents the number of h...

Chemistry, 22.01.2021 04:00

When water is pushed out of the way it is said to be....

Mathematics, 22.01.2021 04:00

Help please for 16 points ...

Mathematics, 22.01.2021 04:00

Jzjdjsnsksljfbslskfbxn ...

More questions: Physics Another questions