subject
Biology, 18.03.2021 02:20 ctaylor15

The carpal bones are held together by ligaments that restrict their mobility to gliding movements. From a functional standpoint, why do you think this arrangement is necessary?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:00
Asolution of an enzyme and a substrate was placed in a water bath and the temperature of the reaction was raised gradually. the graph shown was plotted at the end of the experiment. what can be concluded from the graph? a) temperature has no effect on the activity of the enzyme. b) the effect of temperature on the enzyme is unpredictable. c) the enzyme shows increased activity up to a certain temperature. d) the activity of the enzyme is inversely proportional to the temperature.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 18:00
The table below shows the elements that mainly comprise each of the four layers of earth: elements in layers layer main elements crust oxygen, silicon mantle iron, magnesium outer core iron, nickel inner core iron which of these elements make up the layer that is 0.2 to 1.1 percent of earth's total diameter?
Answers: 2
question
Biology, 22.06.2019 20:30
The hershey and chase experiments involved the preparation of two different types of radioactively labeled phage. which of the following best explains why two preparations were required? a. the bacteriophage used in the experiments was a t2 phage. b. it was necessary that each of the two phage components, dna and protein, be identifiable upon recovery at the end of the experiment. c. each scientist had his own method for labeling phage, so each conducted the same experiment using a different isotope. d. establishing the identity of the genetic material required observation of two phage generations.
Answers: 2
You know the right answer?
The carpal bones are held together by ligaments that restrict their mobility to gliding movements. F...
Questions
Questions on the website: 13722361