<BOAStep-by-step explanation:60°- 40°= 20°40°+20°=60°...

Mathematics, 26.02.2020 22:31 sierrastrickland99

Help bro math sucks

Help broooo math suckssss

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:50

Which of the following points is collinear with (-2,1) and (0,3)

Answers: 3

Answer

Mathematics, 21.06.2019 21:00

Awater tank holds 18000 gallons. how long will it take for the water level to reach 6000 gallons if the water is used at anaverage rate of 450 gallons per day

Answers: 1

Answer

Mathematics, 21.06.2019 21:30

Are the corresponding angles congruent? explain why or why not.

Answers: 2

Answer

Mathematics, 21.06.2019 23:20

Which of the following constants can be added to x2 - 3x to form a perfect square trinomial?

Answers: 1

Answer

You know the right answer?

Help bro math sucks
...

Questions

Chemistry, 04.10.2020 18:01

The boy and the bottle chemistry...

Spanish, 04.10.2020 18:01

Read and choose the best words or expressions that connect to the image. A backpack El lápiz La pluma El cuaderno La mochila...

Mathematics, 04.10.2020 18:01

Mr. Smith is making $25 and hour before his boss gives him a 10% raise. How much will his new hourly wage be? $25.10 $27.50 $50.00...

Chemistry, 04.10.2020 18:01

1s22s22p63s 3p645230104p5 Which element is this? fluorine (F) bromine (Br) chlorine (Cl) krypton (Kr)...

Health, 04.10.2020 18:01

WILL GIVE BRAINLIEST IF ANSWERED CORRECTLY Egg shells are permeable and will a. protect the egg from bacteria. b. add many n...

English, 04.10.2020 18:01

We lived there for three days - Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination th...

Mathematics, 04.10.2020 18:01

The formula for distance traveled dis d = rt, where r is the average speed of the object and t is time traveled. If an object travels 75 meters in 30...

History, 04.10.2020 18:01

According to the Population Density map (p. 107), what is the area of greatest population density found in Canada? Select one a. Near Alaska b. Near G...

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

Mathematics, 04.10.2020 18:01

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

History, 04.10.2020 18:01

Amin 3. How are the New England Colonies alike?...

Biology, 04.10.2020 18:01

Who Believed that species could inherit traits that would help them adapt and survive within an environment...

Geography, 04.10.2020 18:01

Earth's physical layers in sequence...

Mathematics, 04.10.2020 18:01

Given the figure below, find the values of x and z. (14x + 55) (10x + 29)...

History, 04.10.2020 18:01

Which amendment protects citizens from being forced to house troops? O the First Amendment O the Third Amendment O the sixth Amendment

More questions: Mathematics Another questions