subject

Mathematics, 20.10.2020 21:01 jayejaye9289

If f(x)=4x^2+1 and g(x)=x^2-5 find (f-g)(x)

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 14:00

Plz me i need i will give a brain

Answers: 1

question

Mathematics, 21.06.2019 15:50

Arectangle has a width of 9 units and length of 40 units. what is the length of a diognal. a. 31 unitsb. 39 unitsc. 41 units d. 49 units

Answers: 1

question

Mathematics, 21.06.2019 20:00

15m is what percent of 60m; 3m; 30m; 1.5 km? the last one is km not m

Answers: 1

question

Mathematics, 22.06.2019 01:30

Talia took the bus from her home to the bank and then walked back to her home along the same route. the bus traveled at an average speed of 40 km/h and she walked at an average speed of 5 km/h. to determine the time, x, that it took talia to walk home, she used the equation 40(0.9 – x) = 5x. the time of trip 2 is hours. the distance of trip 1 is km.

Answers: 1

You know the right answer?

If f(x)=4x^2+1 and g(x)=x^2-5 find (f-g)(x)...

Questions

question

Business, 28.10.2019 21:31

Acompany sells merchandise on november 2 at a $4,000 invoice price with terms of 2/10, n/30. the goods cost $2,000. the company uses the net method to...

question

Computers and Technology, 28.10.2019 21:31

Your program will first prompt the user to enter a single dna sequence, which it should validate for legality (i. e., only the four valid bases) — you...

question

Mathematics, 28.10.2019 21:31

Afast food chain advertises that their large bag of french fires has a weight of 150 grams. some high school students, who enjoy french fries at every...

question

Chemistry, 28.10.2019 21:31

Potassium permanganate solutions may be standardized by titrating against primary standard sodium oxalate. 2mno4- + 5c2o42- + 16h+  2mn2+ + 10co2 + 8...

question

Computers and Technology, 28.10.2019 21:31

An allocator move allocated blocks to the end of the heap to maximize throughput. select] select should not should 2. an allocator allocate unaligned...

question

Mathematics, 28.10.2019 21:31

The percentage of titanium in an alloy used in aerospace castings is measured in 51 randomly selected parts. the sample standard deviation is s = 0.37...

question

Business, 28.10.2019 21:31

Sold goods costing $1,200 for $2,000 on account. after two weeks the customer returned the goods. there is nothing wrong with the goods; the customer...

question

Business, 28.10.2019 21:31

Two balloons contain the same amounts of water, sugar, and yeast. two other balloons contain the same amount of water, but have no sugar or yeast. the...

question

Spanish, 28.10.2019 21:31

2. javier piensa en abrir una compañía exportadora de café. cierto falso 3. el padre de javier tiene conexiones con contadores en barcelona. ci...

question

Spanish, 28.10.2019 21:31

1- escogermultiple choice activity audio instructionslisten to each question and choose the most logical response. october 18 11: 59 pm 1 attempt rema...

question

Computers and Technology, 28.10.2019 21:31

Python question: write a program that generates a random number in the range of 1 through 100, and asks the user to guess what the number is. if the...

question

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

question

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

question

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

question

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

question

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

question

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

question

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

question

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

question

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

More questions: Mathematics Another questions

Questions on the website: 13722363