subject

Mathematics, 31.01.2020 04:01 davidvickery6656

What is the conjugate of 12 - sqrt 5

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 14:30

Chandler was a caretaker at the state zoo. he noticed that the number of animals adopted by the zoo increased at a constant rate every year since 2010. which of the following graphs shows the slowest rate at which the animals in the zoo were adopted?

Answers: 2

question

Mathematics, 21.06.2019 15:30

Two blends of tea are mixed to make a blend that will be sold at the fair. black tea sells for $2.20 per pound and orange pekoe tea sells for $3.00 per pound. how much of each should be used to obtain a 4lb blend selling for $2.50 per pound?

Answers: 1

question

Mathematics, 21.06.2019 16:40

What is the solution of the systems of equations? y=2/3x+3 x=-2

Answers: 2

question

Mathematics, 21.06.2019 21:40

Many newspapers carry a certain puzzle in which the reader must unscramble letters to form words. how many ways can the letters of emdangl be arranged? identify the correct unscrambling, then determine the probability of getting that result by randomly selecting one arrangement of the given letters.

Answers: 1

You know the right answer?

What is the conjugate of 12 - sqrt 5...

Questions

question

Health, 04.10.2020 18:01

WILL GIVE BRAINLIEST IF ANSWERED CORRECTLY Egg shells are permeable and will a. protect the egg from bacteria. b. add many n...

question

English, 04.10.2020 18:01

We lived there for three days - Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination th...

question

Mathematics, 04.10.2020 18:01

The formula for distance traveled dis d = rt, where r is the average speed of the object and t is time traveled. If an object travels 75 meters in 30...

question

History, 04.10.2020 18:01

According to the Population Density map (p. 107), what is the area of greatest population density found in Canada? Select one a. Near Alaska b. Near G...

question

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

question

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

question

Mathematics, 04.10.2020 18:01

Two similar triangles are shown below: Two triangles are shown. The sides of the triangle on the left are marked 6, 4, 3. The sides of the triangle o...

question

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

question

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

question

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

question

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

question

History, 04.10.2020 18:01

Amin 3. How are the New England Colonies alike?...

question

Biology, 04.10.2020 18:01

Who Believed that species could inherit traits that would help them adapt and survive within an environment...

question

Geography, 04.10.2020 18:01

Earth's physical layers in sequence...

question

Mathematics, 04.10.2020 18:01

Given the figure below, find the values of x and z. (14x + 55) (10x + 29)...

question

History, 04.10.2020 18:01

Which amendment protects citizens from being forced to house troops? O the First Amendment O the Third Amendment O the sixth Amendment

question

Chemistry, 04.10.2020 18:01

Which rate describes a unit price? A.$1.00 for 2 lemons B.$3.00 for every pound C.$4.00 for 3 slices of pizza D.$6.00 for every 6 b...

question

History, 04.10.2020 18:01

From the time of the Declaration of Independence until the ratification of the Constitution, the United States functioned without more than two...

question

Mathematics, 04.10.2020 18:01

1) Solve for x. Х– 4 = -12 А. -8 В.-16 С.16 D.8 ОА Ов Ос OD HINT SUBMIT...

question

Physics, 04.10.2020 18:01

A 2-kg sample of a metal increases in temperature by 20°C when heated on a stove for 3 minutes. Can you predict what will happens to the temperature r...

More questions: Mathematics Another questions

Questions on the website: 13722359