subject

Mathematics, 23.11.2021 01:40 caroline5993

Evaluate the function when x equals -6, 4, 1.

Evaluate the function when x equals -6, 4, 1.

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 20:00

Afamily has five members. a mom, a dad, two sisters, & a brother. the family lines up single file. what is the probabillity that the mom is at the front of the line

Answers: 1

question

Mathematics, 22.06.2019 01:00

Libby built a fence that was 56 \text { feet}56 feet long over 44 days. she built the same length of fence each day. how many inches of fence did libby build each day?

Answers: 1

question

Mathematics, 22.06.2019 02:00

Prove the following(cot0+cosec0)[tex](cot0 + cosec0) { }^{2} = \frac{1 + cos0}{1 - cos0} [/tex]

Answers: 1

question

Mathematics, 22.06.2019 02:00

Look at the example below which shows how the product property of radicals is used to simplify a radical. use the product property of radicals to simplify the following radical.

Answers: 3

You know the right answer?

Evaluate the function when x equals -6, 4, 1.
...

Questions

question

Mathematics, 04.10.2020 18:01

Mr. Smith is making $25 and hour before his boss gives him a 10% raise. How much will his new hourly wage be? $25.10 $27.50 $50.00...

question

Chemistry, 04.10.2020 18:01

1s22s22p63s 3p645230104p5 Which element is this? fluorine (F) bromine (Br) chlorine (Cl) krypton (Kr)...

question

Health, 04.10.2020 18:01

WILL GIVE BRAINLIEST IF ANSWERED CORRECTLY Egg shells are permeable and will a. protect the egg from bacteria. b. add many n...

question

English, 04.10.2020 18:01

We lived there for three days - Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination th...

question

Mathematics, 04.10.2020 18:01

The formula for distance traveled dis d = rt, where r is the average speed of the object and t is time traveled. If an object travels 75 meters in 30...

question

History, 04.10.2020 18:01

According to the Population Density map (p. 107), what is the area of greatest population density found in Canada? Select one a. Near Alaska b. Near G...

question

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

question

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

question

Mathematics, 04.10.2020 18:01

Two similar triangles are shown below: Two triangles are shown. The sides of the triangle on the left are marked 6, 4, 3. The sides of the triangle o...

question

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

question

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

question

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

question

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

question

History, 04.10.2020 18:01

Amin 3. How are the New England Colonies alike?...

question

Biology, 04.10.2020 18:01

Who Believed that species could inherit traits that would help them adapt and survive within an environment...

question

Geography, 04.10.2020 18:01

Earth's physical layers in sequence...

question

Mathematics, 04.10.2020 18:01

Given the figure below, find the values of x and z. (14x + 55) (10x + 29)...

question

History, 04.10.2020 18:01

Which amendment protects citizens from being forced to house troops? O the First Amendment O the Third Amendment O the sixth Amendment

question

Chemistry, 04.10.2020 18:01

Which rate describes a unit price? A.$1.00 for 2 lemons B.$3.00 for every pound C.$4.00 for 3 slices of pizza D.$6.00 for every 6 b...

question

History, 04.10.2020 18:01

From the time of the Declaration of Independence until the ratification of the Constitution, the United States functioned without more than two...

More questions: Mathematics Another questions

Questions on the website: 13722361